Skip to main content

Table 2 Oligonucleotides used in this study with their accompanying mutation identified

From: Mutually dependent degradation of Ama1p and Cdc20p terminates APC/C ubiquitin ligase activity at the completion of meiotic development in yeast

Name Gene target Mutation
Created Oligonucleotide  
Db1 AMA1 RXXL-AXXA ATTGTTGGTACAAAATTTGGCGCTATTCTTGCATATGATCAAAAAGAATTTTTTCATTCC
Db2 AMA1 RXXL-AXXA TTCCCCATAAAAAACTGGAGTAAAGCACGTAAGGCCGAAGATGAAAATTTAATAGGATTGAAA
GXEN AMA1 GXEN-GXAN AAATTTTATGTTGGAGAGGCAAATGGCAATGTGAGCCTCTTTGAA