Skip to main content

Advertisement

Springer Nature is making SARS-CoV-2 and COVID-19 research free. View research | View latest news | Sign up for updates

Table 2 PCR primers used in this study

From: The subunits of the S-phase checkpoint complex Mrc1/Tof1/Csm3: dynamics and interdependence

Primer Aplication Sequence
scm3 F Gene disruption TACTGGATTAAAATGCCATGAAAACGTGAACAGAAACTTTTATTGAGGTCCACTCAACCCTATCTCGG
csm3 R Gene disruption TATAGATGCCCACACGCACGTTTGGATTATTACCTTCAATGACATTGCTACTCGAAATTAACCCTCAC
mrc1 F Gene disruption CTAAGGAAGTTCGTTATTCGCTTTTGAACTTATCACCAAATATTTTAGTGCACTCAACCCTATCTCGG
mrc1 R Gene disruption GACAGCTTCTGGAGTTCAATCAACTTCTTCGGAAAAGATAAAAAACCACTCTCGAAATTAACCCTCAC
tof1 F Gene disruption CATCTAGCTTGTGGGGTTTAGTGTATCTTTAATATAGGAGGGCGCACACTCACTCAACCCTATCTCGG
tof1 R Gene disruption TTCTAAAATTACACGTATTAAAGGGATTAATTACTACATATTCATTCTCACTCGAAATTAACCCTCAC
KanMX-check Diagnostic PCR GTCACCTAAATCGTATGT
csmΔ-check Diagnostic PCR ATCGTTTGACAAGAGAGT
mrc1Δ-check Diagnostic PCR TCAAATGTCCAAGTGAAC
tof1Δ-check Diagnostic PCR GAAGAAGTTACTCCAAGA