Skip to main content

Table 1 Primer sequences used in the real-time quantitative PCR analysis

From: A positive feedback loop between EZH2 and NOX4 regulates nucleus pulposus cell senescence in age-related intervertebral disc degeneration

Target geneForward primerReverse primer
EZH2GAATGGAAGCAGCGAAGGATACAGCAAGTCACTGGTCACTGAACACTCC
p16CGTCGTGCGGTATTTGCGGTATCCGTTGCCAGAAGTGAAGCCAAGG
NOX4ATGGTGGTGGTATTGTTCCTCATCAGCAGCAGCAGCATGTAGA
GAPDHCGGCAAGTTCAACGGCACAGTCGACATACTCAGCACCAGCATCAC
β-ActinTCAGGTCATCACTATCGGCAAT AAAGAAAGGGTGTAAAACGCA
β-CateninCATTACAACTCTCCACAACCCAGATAGCACCTTCAGCA
Wnt11ATGGCATCAAGTGGCTGGCATTATGGCATCAAGTGGCTGGCATT
Wnt6ATGCTGCTGCTGCTGCTCTTGCAACGGAACTGGAACTGACATTCTCG
Mapk8ACAGTGAGCAGAGCAGGCATAGTTTGTCAGGAGCAGCACCATTCTTAC
Wif1CCAGGCGAGAACTTCACAAGCATAGCAGGAGCAGGCAAGGTAGG
  1. NOX4 NADPH oxidase 4, EZH2 enhancer of zeste homolog 2, Wnt6 Wnt family member 6, Wnt11 Wnt family member 11, Wif1 WNT inhibitory factor 1, Mapk8 mitogen-activated protein kinase 8